I hate the fact that breakthroughs like this are patentable.
People need to follow Alexander Flemings lead:
The pharmacist Sir Alexander Fleming is revered not just
because of his discovery of penicillin – the antibiotic
that has saved millions of lives – but also due to his
efforts to ensure that it was freely available to as much
of the world’s population as possible. Fleming could have
become a hugely wealthy man if he had decided to control
and license the substance, but he understood that
penicillin’s potential to overcome diseases such as
syphilis, gangrene and tuberculosis meant it had to be
released into the world to serve the greater good. On the
eve of World War II, he transferred the patents to the US
and UK governments, which were able to mass-produce
penicillin in time to treat many of the wounded in that
war. It has saved many millions of lives since.
From what I've heard, he wouldn't have been the one to decide. That would have been his employer, the National Foundation for Infantile Paralysis. And its lawyers had decided that the vaccine wouldn't be patentable under the rules of that time.
Even if his employer did want to patent his work, considering Salk's huge fame at the time (the guy's a modern dragon slayer), it wouldn't have taken much to convince his employer otherwise. A few interviews here and there and the public outcry would be huge.
No one knows why the lawyers considered a patent application, but it seems likely that they would only have used it to prevent companies from making unlicensed, low-quality versions of the vaccine. There is no indication that the foundation intended to profit from a patent on the polio vaccine.
Why would the public be in an uproar about using patent protections to keep low-quality vaccines out of the market, while otherwise making the license available at no cost?
Why would the public be in an uproar about using patent protections to keep low-quality vaccines out of the market
For one thing you don't need patent protections to keep 'low quality' vaccines out of the market. To my knowledge, that's what government regulatory bodies like the FDA are for.
while otherwise making the license available at no cost?
Even if this was the case, I'm sure that Salk knew that if it was patented, that this would be only temporary (with no guarantees on reasonable pricing in the future); and it would be an unnecessary and immediate roadblock to helping people.
That's what the FDA does now, yes. However, the polio vaccine was introduced when the FDA had weaker powers. It wasn't until after the Thalidomide tragedy and the 1962 Kefauver-Harris Amendment where pharmaceutical companies also needed to demonstrate effectiveness. Before then, companies only needed to demonstrate safety.
As it was, the Cutter polio vaccine incident shows that making the vaccine was not easy.
I'm sure that Salk knew ...
How are you sure? Is this discussed in his biography or autobiography? I see the topic is covered in Jane S. Smith's "Patent the Sun", but I haven't read it.
Other vaccines (or vaccine preparations) at the time were patented. Was your described behavior typical for them?
There's a big difference between exclusive licensing and non-exclusive licensing. New drugs (like penicillin) tend to be exclusively licensed because of the costs involved in regulatory approval, and that can slow down technology diffusion - the wrong licensee can sink the technology.
But enabling technologies (like CRSPR) get licensed non-exclusively, particularly when the patent holder is an academic institution. If the patents around CRSPR are licensed non-exclusively, at reasonably prices, and with appropriate treatment for academic researchers, these patents aren't going to slow science down.
A good example is the original polymerase chain reaction patents, which were held by Cetus. Despite lots of legal arguments, PCR was always widely available.
There is a big difference between PCR and CRISPR though. Whilst PCR is effectively a reading technology, CRISPR is a writing technology. For many medical technologies then PCR is a standalone diagnostic tool (it is HUGE in mol. biol., pathology, biotech). However you can quite easily see CRISPR being a core tech within revolutionary deliverable medical treatments.
As Eisen points out its kind of odd that the group who rush to do the obvious human implementation should then get a share of all this potential... Not really a novel invention by that point in my opinion.
Yes, exclusively licensing CRISPR on an indication-by-indication basis as a therapeutic itself (as someone below has suggested has already happened by Broad) would be worrisome.
If CRISPR gets/stays patented, the part of the world that respects patent law is going to get left out of whatever innovations it yields. Or maybe not completely left behind, but the groups that will be able to license it will number few.
I generally agree that discoveries like this should go in the public domain as quickly as possible.
The pissing contest about "who invented what, when" is fine and good, to a point; nobody cares if "Cancer Immunity 1.0" drug has a tagline "brought to you by Lander's Finest". To the extent that success and notoriety determine careers, and so we should "get it right" so that the "right" people get credit... I think most researchers will persevere and continue to do science (for the benefit of humanity or for personal glory, or whatever) even if they get shafted for credit.
But the technology itself.. get it into everybody's hands and let the thousand flowers bloom already.
Can you own a secret, though? Or is it OK for a government to force you reveal it publicly?
If people have a right to own secrets, and if NDAs can be legally enforced, then a market of (the knowledge of) facts can naturally emerge that's strictly worse than the patent system.
They do a pretty good job regulating drug imports that violate IP, and I suspect they will here as well. The materials in question will be complex human therapeutic compositions, not research materials. I strongly doubt people will be creating therapeutic CRISPR compositions at the workbench (which will also include sophisticated delivery and targeting molecular products).
The inventions of scientists in academia, like employees in the private sector, are owned by their employers. Universities and research institutes typically have a policy to profit from these inventions via patents in order to fund more research.
The people that need to change this are at the administrative level: laws via congress, and then chancellors of universities.
It will take millions of dollars of research to turn this basic bioengineering technique into an approved (safe and effective) human therapy. How do you motivate investors to fund this research without the safety net of a patent to protect that investment from free-loaders?
The way it was done before patents -- government funded research institutions whose only motivation was to provide scientific breakthroughs so they could continue to receive government funding.
There's a huge gap between the scientific breakthrough and the work needed to create a safe and effective therapy. It's not academically interesting, and academic scientists won't do it. It's optimization, not discovery. And what about the cost of the clinical trial, which could be $500m?
Government funded research institutions will continue to provide BREAKTHROUGHS to receive funding.
And what about the cost of the clinical trial, which could be $500m?
That's an interesting one, because that cost is entirely caused by the government. The government could for example fund clinical trials, since they're the ones who are interested in it's results (as is by extension the public).
As for the rest, if the science were freely available without a patent from the scientists, companies could still spend money making it a therapy and making a profit by doing it better and more efficiently than their competitors, and they could still get a patent on their work.
We're talking about making the science patent free, not the product.
It's an interesting distinction here. I would argue that the science is already free. The Cas9 protein is a natural product. The guide RNA can be synthesized easily. What is being patented here is use of Cas9/CRISPR to edit human cells. In a general sense that is actually the product, and not merely "the science." In other cases, where the Cas9 protein is engineered to achieve things like lower off-target cutting rate, that is a pretty classical case of human invention.
That's a very cynical and inaccurate appraisal of "The Time Before Patents."
Most scientific breakthroughs throughout history were pursued due to simple curiosity or necessity, precisely because without an international framework of patent law "patents" and the pursuit of technology as intellectual property directly for financial gain was impossible.
The British for example attempted to control physical access to textile IP but Samuel Slater[1] memorized as much as he could and "exported it" along with himself to the Americas to reap a fortune.
How about the way we do it now, with patents on devices, therapies, and drugs that are approved by the FDA instead of on the techniques used to develop them? There is even a way to extend the patent life of these developments to account for the amount of time it takes to receive government approval with a maximum term of 14 years after approval [1]. Patenting such a fundamental technique as CRISPR will only set back research for more than a decade and prevent most investors from funding further research while giving companies a huge headstart if they are located outside of the USPTO's jurisdiction.
The technique used to develop the therapy is not really what is being patented here. In practice, anyone will be able to use CRISPR for research purposes or to develop therapies. The question is, why would you invest in using this to develop a product when you can't actually sell the therapy? The product in question here is a therapeutic CRISPR composition for use in human cells. Lots of people will still invest in the technology and research because it is so valuable. If you invent a novel variant with better cutting properties, for instance, or a modification that reduces toxicity, those would be novel compositions of matter and could easily be the foundation of a new business venture.
quite simply, you don't. the motivation is to be either first to market, or have some advantage to your process.
If you do the research, you can hold it tight to your chest until it's time to announce your product, by which time you will have a significant advantage over any competition, the amount of time of which is a factor of the difficulty of the subject matter... there's your graduated incentive. low hanging fruit will get plucked. good.
regarding costs of governmental approval: they are a problem. the government will need to use our tax money for this sort of activity rather than shiny new weapons, I suppose. Their fees are absurd. Approval of a specific substance as a treatment for illness ought to be borne by the same public sector that owns it in my common-sensical world i suppose...
This is part of an ongoing dispute between Jinek et al at Berkeley and Zhang et al at the Broad Institute. Both groups did important work on CRISPR-CAS9, and now they're fighting over credit, a patent, and (probably) a Nobel prize. Eric Lander, head of the Broad Institute, recently published an article "The Heroes of CRISPR" which emphasizes his own institution's role and downplays Berkeley's. Michael Eisen, a professor at Berkeley, wrote this article to emphasize Berkeley's role and downplay Broad's. Lander has, apparently, been in a fight like this before, with Craig Venter's group over credit for being first to sequence the human genome.
My own position is that in a sane world, there would be no patent and the groups would share the Nobel. The patent ownership dispute is the only reason there has to be a fight at all, and while patents on techniques in biology aren't nearly as absurd and destructive over patents on software, I think they're almost certainly net negative overall.
While there’s a patent issue, this is an issue of attribution (i.e. ego). I know most would prefer either a non-profit (The Broad Institute of MIT and Harvard) or a public institution (University of California, Berkley) than some commercial entity.
The Broad Institute has given an exclusive license to a commercial entity (Editas Medicine) for certain uses of CRISPR. I don't imagine UC would behave any differently.
My experience with software patents makes me believe that Lander and Zhang, being part of the group that most aggressively pursued patents, are scam artists that should be drummed out of science forever. I actually have to remind myself not to feel hostility toward them.
I know it's not valid reasoning but it would be almost certainly right in software. I'm pretty sure software patents are poisoning the whole patent system both from the inside and in public opinion.
Michael Eisen is a professor at Berkeley, founder of the Public Library of Science and pioneered the use of microarrays for studying gene expression. This blog post is in response to the recent controversy about CRISPR, in particular Eric Lander's article called "The Heroes of CRISPR."
He is also a firebrand who does not care who he upsets, which works for both good and ill. (I have worked with Mike before, although in a distant capacity.)
This explains why he can sometimes appear highly quixotic.
He mentions that very clearly in the article, and also makes it clear what he stands (and does not stand) to gain financially from Lander's article being discredited.
It's a very provocative title, but the policy recommendation in the article—that we stop issuing Nobel prizes and patents to individuals when discoveries happened over a long process—is pretty fair. And he does credit Lander for acknowledging all the scientists that predated both of their universities' work.
It's 'useful' in countering an image that people who only read Lander's paper might come away with, and useful in drawing attention to the problem he (Mike) perceives.
Whether any of this is useful in a broader sense is unclear, but we are almost certainly seeing the most important story in history of biology for this generation unfolding before us.
A Nobel Prize is now at stake. Lifespan, disease and the human race is at stake. The internal scientific politicking on both sides is classic. "by going into depth about the contributions of early CRISPR pioneers, Lander is able to almost literally write Doudna and Charpentier (and, for that matter, genome-editing pioneer George Church, whose CRISPR work has also been largely ignored) out of this history. They are mentioned, of course, but everything about the way they are mentioned is designed to minimize their contributions."
However, it's also clear that Doudna's work was central and a hub for overall advancement.
CRISPR is just one tiny replaceable part of any therapy-driving genome editing technique. The frenzy around it overstates its importance.
Cas9 is significant as the first RNA-guided nuclease that we learned how to manipulate, but there are probably many more in nature. Hopefully we will be able to construct our own in short order.
We have had very high quality programmable nucleases for a long time. Nucleases are not the principal expense in genome engineering. Further, if you want to be sure that the cuts you make are correct and on-target you might want to take the time to use another system than Cas9/tracRNA.
However, dCas9 (disabled Cas'es) and friends are amazingly novel, in that they allow us to make huge libraries of targeted DNA binding complexes that don't cut DNA, but let us pull particular things to particular places in the genome. This is an incredible boon to certain research threads. For example, see http://www.sciencedirect.com/science/article/pii/S0092867413...
A lot of breakthroughs in science have a similar fate. One example was finding that DNA was a double helix with Watson, Crick, and Rosalind Franklin. Watson and Crick got all the credit but Franklin definitely played a major role in that discovery and was mostly written out.
I don't expect that the present and future judges presiding over the patent dispute will give any credence to these pieces. Nobel committee members might.
CRISPR, for those of you who do not know, is an anti-viral immune system found in archaea and bacteria, that until a few years ago, was all but unknown outside the small group of scientists have been studying it since its discovery a quarter century ago. This all changed in 2012, when a paper from colleagues of mine at Berkeley and their collaborators in Europe described a simple way to repurpose components of the CRISPR system of the bacterium Streptococcus pyogenes to cut DNA in a easily programmable manner.
As time goes on, I'm understanding more and more that academic science, which I had naively imagined to be a pure endeavor prosecuted by good-hearted individuals on humanity's behalf, is in fact as dominated by powerful, acquisitive individuals who are more interested in advancing their own power than in human good, knowledge, etc. The pursuit of IP is taking over the university, much to its detriment.
Of the many examples of science getting nasty in the past, one could hardly do better than to revisit the "invention" of calculus. One which raged for at least two decades, and involved names now rightfully known to nearly the entire human race[1]. Then there's the still unresolved mess of who discovered the structure of DNA and the question of whether the Nobel prize partly went to someone who 'stole' the data 'over the shoulder' of someone who should have received far more credit[2]. So over its long history I think we've been very consistent in our discreditable behavior of granting scientific credit; and notice that the business notions of IP are a very recent addition to this struggle. When the treasure is seen as vast, and there's clearly enough for all, that's exactly when sharing is likely to be at a nadir; such is lamentable human nature -sigh-
Science has always been a human endeavor. The politics around mid-20th century physics is a similar minefield.
However, it's far more pure, than, say, typical SV venture capital.
Lander is widely known for being both a scientific and political heavyweight. He knows how to gain power, knows how to wield it, and uses it both to serve scientific goals and his own.
Such use of power has pushed forward science to some degree by allowing considerable economic resources to be applied in a focused manner. But it gets used for other purposes too, because Lander is still a human, and still makes mistakes.
I'm pretty confident that all the people here have human good and knowledge as their highest priority. They just differ on how to achieve it.
If you are Eric Lander, you've already tuned the Broad Institute towards what you expect to be the most fruitful paths of research to improve humankind, and the best way to have it improve humankind is more funding. Michael Eisen might have different opinions on the best paths of research, and you probably have some things you think will pay off that he doesn't, or he thinks will pay off that you don't. It is entirely rational to look at the amount of money available to fund research from public sources and the amount available from private industry, and determine that the best way to save the world is to get that patent and license it aggressively.
And, if you're Michael Eisen, you know that your colleagues are doing excellent work and only one person can own the patent, and that patent going to the Broad represents a significant loss to your colleagues' potential funding, so it's entirely rational to decide the best way to save the world is to contest the patent aggressively.
If we, the onlookers, want to fix this, we need to fix the funding problem. I rather doubt that either Lander or Eisen were driven by desires of patent ownership or denying other people patent ownership when they originally entered the field.
This is about right, but I think you're not properly weighting the rising role of institutional corporatism at research universities. The push for "translational" research was not driven by scientists. Scientists are not idiots, of course. They know when they have something useful. But the institutions built enormous offices filled with lawyers and finance types to promote and manage their "IP portfolios," as if schools suddenly became VCs. The proceeds from this portfolio feeds back only fractionally into research and education, but primarily it funds a vicious circle of administrative executives and contractors who are the main beneficiaries.
IP is just another form of applause, and with it or without it wouldn't matter or change the behavior. People who want the prestige will rise to the occasion and treat the world as a zero sum game.
I thought this article was interesting because it was that first think I've read that actually lays out a seemingly plausible case for why Doudna et al. deserve primary credit rather than Feng at al. The "Whig History of CRISPR" article was interesting, but it left me wanting to hear more about the biology.
I have never seen a paper on CRISPR that can distinguish between selecting pre-existing mutants and actually modifying genes. I have read probably a dozen or so at this point, and it is amazing that they always fail to address this either in citations or actual data.
At first I thought it was an honest mistake, but now it would not surprise me if some of the main players know that their experiments with CRISPR have been misinterpreted. They are then pushing the gene "modification" label anyway because it is sexier.
After all, CRISPR has received an extremely unusual amount of media coverage over the last year or so, which raises red flags. I suspect a marketing effort is being directly funded. That is not a honest use of funds meant for research, especially that which is not meeting minimum scientific standards (ruling out other explanations for the results rather than just a null hypothesis).
It's not clear to me what you are saying. Cas9/CRISPR unambiguously cuts the genome at a target site determined by the guide RNA sequence. In the presence of a DNA oligo with partial complementarity to the cut site, the DNA repair mechanism will sometimes incorporate the "payload" oligo, causing the genetic locus to be engineered from one sequence to another, predetermined sequence.
Start with 10^6 cells. Say 0.1% (1 in 1000) are already mutants at that site. Then add something that kills 100% the non-mutants and you will be left with 10^3 mutants without any gene editing. Say it kills 50% of the non-mutants and renders the rest quiescent due to DNA damage (not dividing), then you are left with 10^3 mutants and 5 x 10^5 non-mutants at time t0. After eg 7 divisions you will have 10^3 x 2^7 = 1.28 x 10^5 mutants, corresponding to 25% of the total.
It depends on the initial number of cells, initial proportion of mutants, division rates, and toxicity. I have also noted that the initial number of cells is usually reported without any uncertainty, which makes me think those numbers may be rather unreliable.
No pre-existing cells have the mutation at the site you're trying to engineer. It just doesn't happen. Otherwise selection alone would be good enough. But mice cells don't have that much intrinsic variation. Plus a lot of time they're inserting whole genes or larger payloads. The statistical probability of that arising from chance is zero.
"No pre-existing cells have the mutation at the site you're trying to engineer. It just doesn't happen."
Not in any paper on CRISPR I have read, in fact just the opposite: there are always low levels of mutants found in the controls (eg Schumann et al 2015 linked below). Please link to the papers that have lead you to make this claim.
I'm assuming you're trolling so I will stop responding. CRISPR isn't my field and I'm not going to dig into supplements to disprove your theory, which is that CRISPR is not real somehow? I work in the Church lab. I know tens of researchers personally who use this technology. I am confident that CRISPR is real. However, attempting to prove this to you is a waste of my time.
Why would you assume someone providing references that contradict your unreferenced claims is trolling? I am not trolling. Also, I am not claiming that the usual mechanism proposed to explain this data is wrong, only that the published data is just as consistent with a selection mechanism. AFAICT, no one knows either way.
Please link to the data that you believe contradicts my proposed mechanism.
My sister was sent by Brazil's government to MIT so she can bring back CRISPR technology to Brazil public universities to speed a research here about using gene editing to control stem cell expression.
I've seen plenty of people and papers where dna was edited in across entirely different organism realms, bacteria dna in animals, animal dna in plants, and so on...
I honestly don't understand how the technique ins't about editing, the only use I saw for it is editing.
EDIT: I asked my sister to give me links to some papers, I will post them after she replies.
But there are plenty of knock-in experiments where foreign DNA was put into the cut site. Are you saying a pre-existing mutant with the foreign DNA was used in those cases too?
Please link to one/some of the papers you are referring to. From what I have seen, they always detect edits in the controls or fail to report enough information to say either way, eg:
"Although rare (∼1–2%), edits were detected with Cas9-only control treatment, including at the predicted CXCR4 cut site, potentially indicating trace amounts of experimental contamination of the Cas9 RNPs."
http://www.pnas.org/content/112/33/10437.full
What other controls do you expect to see? Dataset S1 seems complete to me. There is a similar background level of indels both at the CXCR4 site and off-target 1 and off-target 2 sites. The experiment increases indels at the CXCR4 site, but not at the off-target sites.
The proportion of HDR (ie HindIII reads only) without the template. What percent of cells will randomly mutate to get HindIII recognition sites?
Also, seeing what happens using template only would be good. We would expect low baseline levels of HDR to occur right? I it is plausible few out of 10^5 or 10^6 cells will require repair at that locus even without any Cas9.
The papers I've looked at sequence and measure the on-target mutation rate, and don't have any steps in them that would select for mutants (because that would ruin the measurement). Where do you propose the selection for mutants would be happening?
Unless I'm misunderstanding something about how the experiments are done, your theory would require many groups to be independently committing scientific fraud, which is very implausible.
No fraud is necessary, just sloppy interpretation of data.
Staying with Schuman et al (2015) linked in this thread, they start with 2.5 x 10^5 cells and end up with 5 x 10^4 to 2 x 10^5 three to four days later. Why are there fewer cells even without accounting for any division? Because the treatment is toxic. This is reported in many papers.
I don't know what the proliferation rate is like for the cells in the conditions of that study, but apparently up to 7 divisions in 4 days is considered plausible for T-cells: http://www.ncbi.nlm.nih.gov/pubmed/17367338
If you're right and CRISPR doesn't actually work, then none of the papers published so far are replicable and you'll be vindicated in mere months. If that doesn't happen, then there's a flaw in the style of reasoning and research that led you to conclude the existing papers were flawed. I recommend jotting down a few notes about how you came to this conclusion, and making a calendar reminder to check how it turned out next year.
"If you're right and CRISPR doesn't actually work, then none of the papers published so far are replicable and you'll be vindicated in mere months."
Not at all. I'm not sure you understand what I am saying.
It appears to me the data can be interpreted in multiple ways. Two different "theories" can explain the same results. This is a much more insidious problem than mere non-replication (I haven't seen any direct replications regarding CRISPR either though). People can continue on the wrong path for a long time by interpreting good, reliable data incorrectly.
Lol, what, just what... the biophysics of the Cas9 system are understood pretty well. We literally get as close as you can get to observing the accepted mechanism of action. How would you explain the consistency of site specific gene integration? You can't be selecting from existing mutants and "just happen" to get your transgenic product inserted at the exact site you specified. Your comment is just absurd. You also don't seem to realize that CRISPR is used at pretty much every university in dozens of different systems by thousands of different scientists. What a bizarre comment.
Edit: uh, if you actually need a "source" for this:
"You can't be selecting from existing mutants and "just happen" to get your transgenic product inserted at the exact site you specified. Your comment is just absurd."
This is very easy. If you take a very many cells, some small percent will be mutants at any given site (unless you claim zero background rates of mutation, which is absurd and also directly contradicted by the data in these same papers). If you give a treatment that raises/causes the affinity of DNA damaging substances for a certain site, this will selectively damage the DNA of the non-mutant cells. The proliferation of the non-mutants will be suppressed and many will die off. The remaining mutants will proliferate to fill the gap. See my other post for a (very simple) mathematical model of this phenomenon.
This is not absurd at all. It is basic logic and algebra. I will check that paper and get back to you. I actually have not read any using bacterial cells yet, thanks. Also, as far as I know there are no mathematical models of the standard proposed CRISPR mechanism that have been published, if you know of one that would be great.
That might be possible if CRISPR was just a site specific knock out system.
It's not. Your theory does not explain how site specific gene integration of transgenic products is possible if CRISPR/Cas is not an efficient site specific nuclease. If Cas9 is not cutting the DNA at the specific site so the transgenic product can integrate there, we wouldn't be getting the results seen.
What experiment in that paper do you think addresses the issue of selection vs modification? Both require the cleavage of specific DNA sequences, that is all I see reported in Gasiunas et al 2012.
Here, listen. The following two papers conclusively "disprove" your idea. Both use single embryo injection and show multiple successful site specific mutagenesis in groups of no more than 5 to 25 cells.
Yang et al (2013): "To assess whether a marker transgene could be inserted into an endogenous locus, we coinjected Cas9 mRNA, sgRNA, and a double-stranded donor vector that was designed to fuse a p2AmCherry reporter with the last codon of the Nanog gene (Figure 2A). A circular donor vector was used to minimize random integrations. To assess toxicity and to optimize the concentration of donor DNA, we microinjected different amounts of Nanog-2A-mCherry vector. Injection with a high concentration of donor DNA (500 ng/ml) yielded mCherry-positive embryos with high efficiency, with most blastocysts being retarded, whereas injection with a lower donor DNA concentration (10 ng/ml) yielded mostly healthy blastocysts, most of which were mCherry-negative. When 200 ng/ml donor DNA was used, 75% (936/1,262) of the injected zygotes developed to blastocysts, 9% (86/936) of which were mCherry-positive (Figure 2C; Table S1)."
So efficiency is inversely proportional to toxicity, they treated many more than 5-25 cells (the selection would occur at the level of the embryo), and there was only 1-10% rate of mutation detection. Also, they used "Superovulated female B6D2F1 mice". This procedure leads to chromosomal abnormalities and probably genetic instability so we would expect elevated presence of mutations at any given site: http://jhered.oxfordjournals.org/content/77/1/39.full.pdf
I'll have to look closer at the HDR aspect though (primers used, etc). But what may be going on that usually they detect the insertion via PCR: there is one primer to a sequence unique to the cassette and another upstream or downstream that should only be in the cells. Then the segment spanning the junction is amplified which supposedly is conclusive evidence of insertion at the correct location. The problem is you can get single primer amplification and also the homology arms required for HDR are likely to contain similar sequences to the "cell-only" primer. Eg:
http://link.springer.com/protocol/10.1385%2F0-89603-258-2%3A...
Hwang et al 2013: "On the next day, injected embryos were inspected under stereoscope and were classified as dead, deformed or normal phenotypes. Only embryos that developed normally were assayed for target site mutations"
They don't seem to tell us how many embryos were injected. And that study does not appear to use any type of control group at all. AFAICT, that is exactly the type of study that is consistent with a selection effect.
I'm not an expert in this area, but I still don't understand how you manage to reconcile site specific transgene insertion. In these studies reporter genes are clearly inserted and heritable. How is there anything more to the discussion?
"We show here that in a subset of these systems, the mature crRNA that is base-paired to trans-activating crRNA (tracrRNA) forms a two-RNA structure that directs the CRISPR-associated protein Cas9 to introduce double-stranded (ds) breaks in target DNA. At sites complementary to the crRNA-guide sequence, the Cas9 HNH nuclease domain cleaves the complementary strand, whereas the Cas9 RuvC-like domain cleaves the noncomplementary strand. The dual-tracrRNA:crRNA, when engineered as a single RNA chimera, also directs sequence-specific Cas9 dsDNA cleavage."
Which part of that mechanism do you doubt? It sounds like you doubt the dsDNA nuclease activity of Cas9. Why not just order a plasmid, some Cas9 + gdna, put them together and sanger sequence your products? If Cas9 isn't a site specific guided endonuclease you could prove it for $200.
"It sounds like you doubt the dsDNA nuclease activity of Cas9."
Not at all. This would be why the treatment is toxic and suppressive of proliferation.
At this point, I still think the presence of indels at the site (ie the proposed NHEJ mechanism) is just as easily explained by selection for pre-existing mutants. The experiments involving insertion of DNA (ie the proposed HDR mechanism) are better, but lack controls for "off-target" PCR amplification when showing the gels. IE we need to know how often the template itself will be amplified under their primers/conditions, both free and if it gets incorporated in some random location.
When segments across the insertion junction are amplified, sequenced, and reported, I find this convincing as it is a precise prediction that matches the data and I can think of no other explanation. The other experiments are pretty much redundant and add nothing. However, the reports I have seen contain little methodological or quantitative information regarding these sequences which does make me remain skeptical, especially about claims of efficiency. Those claims seem to always be determined using the former experiments that can be explained in other ways.
No one has to address alternative hypotheses that don't make any sense. Are you unaware that Sanger Sequencing exists, and the actual lesions can be read? Or that heterologous genes are being introduced with CRISPR methods? Neither of these common results can be explained by the spontaneous insertion of hundreds of nucleotides that happen to precisely match the sequence of the construct being inserted.
Again, this is utter nonsense and demonstrates a complete absence of basic understanding in molecular biology.
"Are you unaware that Sanger Sequencing exists, and the actual lesions can be read? Or that heterologous genes are being introduced with CRISPR methods? Neither of these common results can be explained by the spontaneous insertion of hundreds of nucleotides that happen to precisely match the sequence of the construct being inserted."
The first is just as consistent with the selection mechanism, because low levels of baseline mutants ARE reported (see the Schumann et al and Hendel et al papers I linked to in this thread for examples).
The second would indeed be difficult to explain with a selection mechanism, unfortunately I have not seen that actually published. Instead, the primers used can just as well be amplifying the template and/or the sequence of the inserted cassette is not shown (eg Figure 2D and S1 here: http://www.sciencemag.org/content/348/6233/442 )
If you have a reference to a specific paper I would appreciate it.
What do you mean by the primers can just well be amplifying the template? How does that explain knock-ins without an actual insertion? And there are plenty of knock-in CRISPR papers out there. Just literally search for "CRISPR knock-in".
Let me ask this. Say you have sequence A that is not supposed to exist before your treatment and sequence B that you have added to the environment in large amounts. Is it safe to use primers where one matches exactly to sequence B and the other is this similar?
Are you suggesting that they are just detecting the un-incorporated foreign DNA after CRISPR? I think the fact it has been shown that the knocked-in DNA is inherited to the progeny is strong enough evidence that the DNA was actually inserted.
Unless you want to argue that the un-incorporated DNA was also transmitted to the next generation, which honestly, is extremely unlikely.
That could possibly explain some results, but not those involving transmission. If the knocked-in DNA is transmitted to the next generation then I'd think it must have gotten incorporated somewhere, however, this need not be at the intended site if the primers are amplifying the template.
Then again, supposedly shingles is caused by extragenomic Varicella-zoster DNA that is somehow stable for decades and can be passed on during pregnancy. I'm not sure I believe that though, and of course that is viral DNA.
Anyway, in that Ruan et al (2015) they claim to have detected exactly the expected sequence across the junction in at least a few cells. I can't think of any explanation for that data other than CRISPR working as advertised. However, they don't report in what percent of the cells this was observed.
Edit:
I mean supposedly those exact sequences shown in figure S2 never physically existed before and now they do, exactly as predicted by the theory. That is strong evidence.
Here is another. At first you may think they show successful insertion of GFP, but it turns out no! Instead all that needed to happen was mutation of an early stop codon:
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3712628/
That is why I am asking others to provide their own references. The papers I have read do not seem capable of distinguishing between modification vs selection after careful inspection.
the fight over CRISPR (which is a discovery of nature, not a creation), especially the fight over the monopoly to apply CRISPR to other fields of science is another example of why the GNU General Public License (or something with as many teeth) is required to keep science open and free.
CRISPR is a mechanism by which some species of bacteria and archea can edit a virus out of their genome -- it's essentially a small immune system. CRISPR is "hot" right now because of the potential to use it to edit arbitrary genomes. Bear in mind that the technique has a long way to go. It's more or less impossible to do it right now without causing a lot of side effects elsewhere in the genome.
As with most science, this has taken a long time and been the result of work by many, many scientists. Some scientists have big egos and are fighting about who the "real genius" is. Furthermore, it's widely thought that there's going to be a lot of money in this technique, if you can get a patent on it.
TL;DR; cool and potentially very useful science happened, now big egos, big greed, and people who would rather get rich and win a Nobel prize than share the discovery and its benefits with the world are having a fight about it.
Lander wrote an article in "Cell" about the history as he saw it of the invention of the Crispr technique. It covered the bases but was flawed, but it did include a lot of scientists that weren't included before. The article basically tries to discredit it. It wasn't a great argument and frankly the authors not a impartial (Friends with one of the scientist, and works at one of the universities) I'm surprised it made it this far on Hacker News.
There is a patent dispute about who owns the patent on this technique. Lots of money is potentially at stake. This article was written from one of the parties (Broad institute and UC Berkely) being one of them.
Oddly the Lander article supports the notion that this invention is evolution not revolutionary.
Broad has been working to move from from CRISPR/CAS9 to CRISPR/Something else better). The UC Berkley seems to have come up with it first, but is it obvious or obvious to use in editing is the question. The UC [2]team has pulled all there patent claims and resubmitted them twice, presumably to broaden the scope and cover any use. Add some east coast/west coast rivalry and some other biases and you have a powder keg of science.
Anyway lots of blame to go around.
siyer posted this in a previous article which puts the patent dispute in context and if the patent is only cas9:
There’s a patent issue too, but it’s difficult to evaluate since the issue is between a non-profit (The Broad Institute of MIT and Harvard) and a public institution (University of California, Berkley) and most people acknowledge that either would be better for progress than any commercial entity.
Comments
I hate the fact that breakthroughs like this are patentable.
People need to follow Alexander Flemings lead:
http://www.mobileworldlive.com/blog/penicillin-the-antidote-...Jonah Salk, the guy who developed the polio vaccine
"When asked who owned the patent to it, Salk said, 'There is no patent. Could you patent the sun?'"
From what I've heard, he wouldn't have been the one to decide. That would have been his employer, the National Foundation for Infantile Paralysis. And its lawyers had decided that the vaccine wouldn't be patentable under the rules of that time.
Even if his employer did want to patent his work, considering Salk's huge fame at the time (the guy's a modern dragon slayer), it wouldn't have taken much to convince his employer otherwise. A few interviews here and there and the public outcry would be huge.
It would surely depend on the patent license, no? As http://www.slate.com/articles/technology/history_of_innovati... points out:
Why would the public be in an uproar about using patent protections to keep low-quality vaccines out of the market, while otherwise making the license available at no cost?
For one thing you don't need patent protections to keep 'low quality' vaccines out of the market. To my knowledge, that's what government regulatory bodies like the FDA are for.
Even if this was the case, I'm sure that Salk knew that if it was patented, that this would be only temporary (with no guarantees on reasonable pricing in the future); and it would be an unnecessary and immediate roadblock to helping people.
That's what the FDA does now, yes. However, the polio vaccine was introduced when the FDA had weaker powers. It wasn't until after the Thalidomide tragedy and the 1962 Kefauver-Harris Amendment where pharmaceutical companies also needed to demonstrate effectiveness. Before then, companies only needed to demonstrate safety.
As it was, the Cutter polio vaccine incident shows that making the vaccine was not easy.
How are you sure? Is this discussed in his biography or autobiography? I see the topic is covered in Jane S. Smith's "Patent the Sun", but I haven't read it.
Other vaccines (or vaccine preparations) at the time were patented. Was your described behavior typical for them?
There's a big difference between exclusive licensing and non-exclusive licensing. New drugs (like penicillin) tend to be exclusively licensed because of the costs involved in regulatory approval, and that can slow down technology diffusion - the wrong licensee can sink the technology.
But enabling technologies (like CRSPR) get licensed non-exclusively, particularly when the patent holder is an academic institution. If the patents around CRSPR are licensed non-exclusively, at reasonably prices, and with appropriate treatment for academic researchers, these patents aren't going to slow science down.
A good example is the original polymerase chain reaction patents, which were held by Cetus. Despite lots of legal arguments, PCR was always widely available.
Here's a nice analysis of the PCR patent situation and its effects on technology diffusion: http://www.ncbi.nlm.nih.gov/pmc/articles/PMC1523369/
There is a big difference between PCR and CRISPR though. Whilst PCR is effectively a reading technology, CRISPR is a writing technology. For many medical technologies then PCR is a standalone diagnostic tool (it is HUGE in mol. biol., pathology, biotech). However you can quite easily see CRISPR being a core tech within revolutionary deliverable medical treatments.
As Eisen points out its kind of odd that the group who rush to do the obvious human implementation should then get a share of all this potential... Not really a novel invention by that point in my opinion.
Yes, exclusively licensing CRISPR on an indication-by-indication basis as a therapeutic itself (as someone below has suggested has already happened by Broad) would be worrisome.
If CRISPR gets/stays patented, the part of the world that respects patent law is going to get left out of whatever innovations it yields. Or maybe not completely left behind, but the groups that will be able to license it will number few.
I generally agree that discoveries like this should go in the public domain as quickly as possible.
The pissing contest about "who invented what, when" is fine and good, to a point; nobody cares if "Cancer Immunity 1.0" drug has a tagline "brought to you by Lander's Finest". To the extent that success and notoriety determine careers, and so we should "get it right" so that the "right" people get credit... I think most researchers will persevere and continue to do science (for the benefit of humanity or for personal glory, or whatever) even if they get shafted for credit.
But the technology itself.. get it into everybody's hands and let the thousand flowers bloom already.
This is a problematic phrase: https://en.wikipedia.org/wiki/Hundred_Flowers_Campaign
I think the notion that one can own facts will one day be viewed as archaic as the notion that one can own people.
Can you own a secret, though? Or is it OK for a government to force you reveal it publicly?
If people have a right to own secrets, and if NDAs can be legally enforced, then a market of (the knowledge of) facts can naturally emerge that's strictly worse than the patent system.
They don't own any facts. They own the ability to exclude others from selling, as well as importing/exporting, certain materials.
Which is going to break down quickly when anyone can replicate those materials at little cost on their workbench.
They do a pretty good job regulating drug imports that violate IP, and I suspect they will here as well. The materials in question will be complex human therapeutic compositions, not research materials. I strongly doubt people will be creating therapeutic CRISPR compositions at the workbench (which will also include sophisticated delivery and targeting molecular products).
The inventions of scientists in academia, like employees in the private sector, are owned by their employers. Universities and research institutes typically have a policy to profit from these inventions via patents in order to fund more research.
The people that need to change this are at the administrative level: laws via congress, and then chancellors of universities.
Also Banting, the discoverer of insulin (or at least its potential to treat diabetes).
It will take millions of dollars of research to turn this basic bioengineering technique into an approved (safe and effective) human therapy. How do you motivate investors to fund this research without the safety net of a patent to protect that investment from free-loaders?
The way it was done before patents -- government funded research institutions whose only motivation was to provide scientific breakthroughs so they could continue to receive government funding.
There's a huge gap between the scientific breakthrough and the work needed to create a safe and effective therapy. It's not academically interesting, and academic scientists won't do it. It's optimization, not discovery. And what about the cost of the clinical trial, which could be $500m?
Government funded research institutions will continue to provide BREAKTHROUGHS to receive funding.
That's an interesting one, because that cost is entirely caused by the government. The government could for example fund clinical trials, since they're the ones who are interested in it's results (as is by extension the public).
As for the rest, if the science were freely available without a patent from the scientists, companies could still spend money making it a therapy and making a profit by doing it better and more efficiently than their competitors, and they could still get a patent on their work.
We're talking about making the science patent free, not the product.
It's an interesting distinction here. I would argue that the science is already free. The Cas9 protein is a natural product. The guide RNA can be synthesized easily. What is being patented here is use of Cas9/CRISPR to edit human cells. In a general sense that is actually the product, and not merely "the science." In other cases, where the Cas9 protein is engineered to achieve things like lower off-target cutting rate, that is a pretty classical case of human invention.
Exactly. An evaluation of the efficiency of "buying" clinical trials with patents would be very interesting.
That's a very cynical and inaccurate appraisal of "The Time Before Patents."
Most scientific breakthroughs throughout history were pursued due to simple curiosity or necessity, precisely because without an international framework of patent law "patents" and the pursuit of technology as intellectual property directly for financial gain was impossible.
The British for example attempted to control physical access to textile IP but Samuel Slater[1] memorized as much as he could and "exported it" along with himself to the Americas to reap a fortune.
[1]https://en.wikipedia.org/wiki/Samuel_Slater
What if someone want to cure a disease that the government doesn't care about?
How about the way we do it now, with patents on devices, therapies, and drugs that are approved by the FDA instead of on the techniques used to develop them? There is even a way to extend the patent life of these developments to account for the amount of time it takes to receive government approval with a maximum term of 14 years after approval [1]. Patenting such a fundamental technique as CRISPR will only set back research for more than a decade and prevent most investors from funding further research while giving companies a huge headstart if they are located outside of the USPTO's jurisdiction.
[1] http://www.fda.gov/Drugs/DevelopmentApprovalProcess/SmallBus...
The technique used to develop the therapy is not really what is being patented here. In practice, anyone will be able to use CRISPR for research purposes or to develop therapies. The question is, why would you invest in using this to develop a product when you can't actually sell the therapy? The product in question here is a therapeutic CRISPR composition for use in human cells. Lots of people will still invest in the technology and research because it is so valuable. If you invent a novel variant with better cutting properties, for instance, or a modification that reduces toxicity, those would be novel compositions of matter and could easily be the foundation of a new business venture.
quite simply, you don't. the motivation is to be either first to market, or have some advantage to your process. If you do the research, you can hold it tight to your chest until it's time to announce your product, by which time you will have a significant advantage over any competition, the amount of time of which is a factor of the difficulty of the subject matter... there's your graduated incentive. low hanging fruit will get plucked. good.
regarding costs of governmental approval: they are a problem. the government will need to use our tax money for this sort of activity rather than shiny new weapons, I suppose. Their fees are absurd. Approval of a specific substance as a treatment for illness ought to be borne by the same public sector that owns it in my common-sensical world i suppose...
I think that means you hate breakthroughs.
This is part of an ongoing dispute between Jinek et al at Berkeley and Zhang et al at the Broad Institute. Both groups did important work on CRISPR-CAS9, and now they're fighting over credit, a patent, and (probably) a Nobel prize. Eric Lander, head of the Broad Institute, recently published an article "The Heroes of CRISPR" which emphasizes his own institution's role and downplays Berkeley's. Michael Eisen, a professor at Berkeley, wrote this article to emphasize Berkeley's role and downplay Broad's. Lander has, apparently, been in a fight like this before, with Craig Venter's group over credit for being first to sequence the human genome.
My own position is that in a sane world, there would be no patent and the groups would share the Nobel. The patent ownership dispute is the only reason there has to be a fight at all, and while patents on techniques in biology aren't nearly as absurd and destructive over patents on software, I think they're almost certainly net negative overall.
While there’s a patent issue, this is an issue of attribution (i.e. ego). I know most would prefer either a non-profit (The Broad Institute of MIT and Harvard) or a public institution (University of California, Berkley) than some commercial entity.
The Broad Institute has given an exclusive license to a commercial entity (Editas Medicine) for certain uses of CRISPR. I don't imagine UC would behave any differently.
This article has a little more background: http://www.statnews.com/2016/01/25/why-eric-lander-morphed/
My experience with software patents makes me believe that Lander and Zhang, being part of the group that most aggressively pursued patents, are scam artists that should be drummed out of science forever. I actually have to remind myself not to feel hostility toward them.
I know it's not valid reasoning but it would be almost certainly right in software. I'm pretty sure software patents are poisoning the whole patent system both from the inside and in public opinion.
After reading the article, it appears that the author shares your position that both groups should share the credit, FWIW
Michael Eisen is a professor at Berkeley, founder of the Public Library of Science and pioneered the use of microarrays for studying gene expression. This blog post is in response to the recent controversy about CRISPR, in particular Eric Lander's article called "The Heroes of CRISPR."
He is also a firebrand who does not care who he upsets, which works for both good and ill. (I have worked with Mike before, although in a distant capacity.) This explains why he can sometimes appear highly quixotic.
and friend and colleague of Jennifer Doudna.
What’s the path forward? Is labeling Lander a “villain” useful?
He mentions that very clearly in the article, and also makes it clear what he stands (and does not stand) to gain financially from Lander's article being discredited.
It's a very provocative title, but the policy recommendation in the article—that we stop issuing Nobel prizes and patents to individuals when discoveries happened over a long process—is pretty fair. And he does credit Lander for acknowledging all the scientists that predated both of their universities' work.
I don’t disagree. But I’m asking, what should happen in the next few months?
Is reconciliation possible? What would it take?
It's 'useful' in countering an image that people who only read Lander's paper might come away with, and useful in drawing attention to the problem he (Mike) perceives.
Whether any of this is useful in a broader sense is unclear, but we are almost certainly seeing the most important story in history of biology for this generation unfolding before us.
It's useful when you are pushing an agenda.
A Nobel Prize is now at stake. Lifespan, disease and the human race is at stake. The internal scientific politicking on both sides is classic. "by going into depth about the contributions of early CRISPR pioneers, Lander is able to almost literally write Doudna and Charpentier (and, for that matter, genome-editing pioneer George Church, whose CRISPR work has also been largely ignored) out of this history. They are mentioned, of course, but everything about the way they are mentioned is designed to minimize their contributions."
However, it's also clear that Doudna's work was central and a hub for overall advancement.
CRISPR is just one tiny replaceable part of any therapy-driving genome editing technique. The frenzy around it overstates its importance.
Cas9 is significant as the first RNA-guided nuclease that we learned how to manipulate, but there are probably many more in nature. Hopefully we will be able to construct our own in short order.
We have had very high quality programmable nucleases for a long time. Nucleases are not the principal expense in genome engineering. Further, if you want to be sure that the cuts you make are correct and on-target you might want to take the time to use another system than Cas9/tracRNA.
However, dCas9 (disabled Cas'es) and friends are amazingly novel, in that they allow us to make huge libraries of targeted DNA binding complexes that don't cut DNA, but let us pull particular things to particular places in the genome. This is an incredible boon to certain research threads. For example, see http://www.sciencedirect.com/science/article/pii/S0092867413...
A lot of breakthroughs in science have a similar fate. One example was finding that DNA was a double helix with Watson, Crick, and Rosalind Franklin. Watson and Crick got all the credit but Franklin definitely played a major role in that discovery and was mostly written out.
From what I broadly understand from CRISPR, the Nobel is almost a footnote in history, the real prize seems to be the patent.
I don't expect that the present and future judges presiding over the patent dispute will give any credence to these pieces. Nobel committee members might.
It looks like Professor Eisen's blog is down at the moment. Here's a link to the Google cache of that page: http://webcache.googleusercontent.com/search?q=cache:http://...
As time goes on, I'm understanding more and more that academic science, which I had naively imagined to be a pure endeavor prosecuted by good-hearted individuals on humanity's behalf, is in fact as dominated by powerful, acquisitive individuals who are more interested in advancing their own power than in human good, knowledge, etc. The pursuit of IP is taking over the university, much to its detriment.
Of the many examples of science getting nasty in the past, one could hardly do better than to revisit the "invention" of calculus. One which raged for at least two decades, and involved names now rightfully known to nearly the entire human race[1]. Then there's the still unresolved mess of who discovered the structure of DNA and the question of whether the Nobel prize partly went to someone who 'stole' the data 'over the shoulder' of someone who should have received far more credit[2]. So over its long history I think we've been very consistent in our discreditable behavior of granting scientific credit; and notice that the business notions of IP are a very recent addition to this struggle. When the treasure is seen as vast, and there's clearly enough for all, that's exactly when sharing is likely to be at a nadir; such is lamentable human nature -sigh-
[1] https://en.wikipedia.org/wiki/Leibniz%E2%80%93Newton_calculu...
[2] https://en.wikipedia.org/wiki/Rosalind_Franklin#Contribution...
Science has always been a human endeavor. The politics around mid-20th century physics is a similar minefield.
However, it's far more pure, than, say, typical SV venture capital.
Lander is widely known for being both a scientific and political heavyweight. He knows how to gain power, knows how to wield it, and uses it both to serve scientific goals and his own.
Such use of power has pushed forward science to some degree by allowing considerable economic resources to be applied in a focused manner. But it gets used for other purposes too, because Lander is still a human, and still makes mistakes.
I'm pretty confident that all the people here have human good and knowledge as their highest priority. They just differ on how to achieve it.
If you are Eric Lander, you've already tuned the Broad Institute towards what you expect to be the most fruitful paths of research to improve humankind, and the best way to have it improve humankind is more funding. Michael Eisen might have different opinions on the best paths of research, and you probably have some things you think will pay off that he doesn't, or he thinks will pay off that you don't. It is entirely rational to look at the amount of money available to fund research from public sources and the amount available from private industry, and determine that the best way to save the world is to get that patent and license it aggressively.
And, if you're Michael Eisen, you know that your colleagues are doing excellent work and only one person can own the patent, and that patent going to the Broad represents a significant loss to your colleagues' potential funding, so it's entirely rational to decide the best way to save the world is to contest the patent aggressively.
If we, the onlookers, want to fix this, we need to fix the funding problem. I rather doubt that either Lander or Eisen were driven by desires of patent ownership or denying other people patent ownership when they originally entered the field.
This is about right, but I think you're not properly weighting the rising role of institutional corporatism at research universities. The push for "translational" research was not driven by scientists. Scientists are not idiots, of course. They know when they have something useful. But the institutions built enormous offices filled with lawyers and finance types to promote and manage their "IP portfolios," as if schools suddenly became VCs. The proceeds from this portfolio feeds back only fractionally into research and education, but primarily it funds a vicious circle of administrative executives and contractors who are the main beneficiaries.
IP is just another form of applause, and with it or without it wouldn't matter or change the behavior. People who want the prestige will rise to the occasion and treat the world as a zero sum game.
This particular piece of IP is probably worth billions of dollars. I think that's a little better than applause.
With "intellectual property" (patents in this case) it is a zero sum game.
They would do it anyway, it just makes it more news worthy given the patents. Although, I'm not sure its zero sum depending on how it shakes out.
I thought this article was interesting because it was that first think I've read that actually lays out a seemingly plausible case for why Doudna et al. deserve primary credit rather than Feng at al. The "Whig History of CRISPR" article was interesting, but it left me wanting to hear more about the biology.
I have never seen a paper on CRISPR that can distinguish between selecting pre-existing mutants and actually modifying genes. I have read probably a dozen or so at this point, and it is amazing that they always fail to address this either in citations or actual data.
At first I thought it was an honest mistake, but now it would not surprise me if some of the main players know that their experiments with CRISPR have been misinterpreted. They are then pushing the gene "modification" label anyway because it is sexier.
After all, CRISPR has received an extremely unusual amount of media coverage over the last year or so, which raises red flags. I suspect a marketing effort is being directly funded. That is not a honest use of funds meant for research, especially that which is not meeting minimum scientific standards (ruling out other explanations for the results rather than just a null hypothesis).
It's not clear to me what you are saying. Cas9/CRISPR unambiguously cuts the genome at a target site determined by the guide RNA sequence. In the presence of a DNA oligo with partial complementarity to the cut site, the DNA repair mechanism will sometimes incorporate the "payload" oligo, causing the genetic locus to be engineered from one sequence to another, predetermined sequence.
Start with 10^6 cells. Say 0.1% (1 in 1000) are already mutants at that site. Then add something that kills 100% the non-mutants and you will be left with 10^3 mutants without any gene editing. Say it kills 50% of the non-mutants and renders the rest quiescent due to DNA damage (not dividing), then you are left with 10^3 mutants and 5 x 10^5 non-mutants at time t0. After eg 7 divisions you will have 10^3 x 2^7 = 1.28 x 10^5 mutants, corresponding to 25% of the total.
It depends on the initial number of cells, initial proportion of mutants, division rates, and toxicity. I have also noted that the initial number of cells is usually reported without any uncertainty, which makes me think those numbers may be rather unreliable.
No pre-existing cells have the mutation at the site you're trying to engineer. It just doesn't happen. Otherwise selection alone would be good enough. But mice cells don't have that much intrinsic variation. Plus a lot of time they're inserting whole genes or larger payloads. The statistical probability of that arising from chance is zero.
Not in any paper on CRISPR I have read, in fact just the opposite: there are always low levels of mutants found in the controls (eg Schumann et al 2015 linked below). Please link to the papers that have lead you to make this claim.
That is far more easily explained by contamination, which, as you mention, is actually how they explain it in papers.
Here is another (supplementary table 2). https://www.ncbi.nlm.nih.gov/pubmed/26121415
I can keep going, but would prefer you bring references of your own so I cannot be accused of cherry picking.
I'm assuming you're trolling so I will stop responding. CRISPR isn't my field and I'm not going to dig into supplements to disprove your theory, which is that CRISPR is not real somehow? I work in the Church lab. I know tens of researchers personally who use this technology. I am confident that CRISPR is real. However, attempting to prove this to you is a waste of my time.
Why would you assume someone providing references that contradict your unreferenced claims is trolling? I am not trolling. Also, I am not claiming that the usual mechanism proposed to explain this data is wrong, only that the published data is just as consistent with a selection mechanism. AFAICT, no one knows either way.
Please link to the data that you believe contradicts my proposed mechanism.
My sister was sent by Brazil's government to MIT so she can bring back CRISPR technology to Brazil public universities to speed a research here about using gene editing to control stem cell expression.
I've seen plenty of people and papers where dna was edited in across entirely different organism realms, bacteria dna in animals, animal dna in plants, and so on...
I honestly don't understand how the technique ins't about editing, the only use I saw for it is editing.
EDIT: I asked my sister to give me links to some papers, I will post them after she replies.
Thanks, I appreciate it. This has been bugging me for awhile now.
You'll have to link to the exact evidence and methods you are referring to.
But there are plenty of knock-in experiments where foreign DNA was put into the cut site. Are you saying a pre-existing mutant with the foreign DNA was used in those cases too?
Please link to one/some of the papers you are referring to. From what I have seen, they always detect edits in the controls or fail to report enough information to say either way, eg:
"Although rare (∼1–2%), edits were detected with Cas9-only control treatment, including at the predicted CXCR4 cut site, potentially indicating trace amounts of experimental contamination of the Cas9 RNPs." http://www.pnas.org/content/112/33/10437.full
Note the curiously missing rows in dataset S1.
What other controls do you expect to see? Dataset S1 seems complete to me. There is a similar background level of indels both at the CXCR4 site and off-target 1 and off-target 2 sites. The experiment increases indels at the CXCR4 site, but not at the off-target sites.
The proportion of HDR (ie HindIII reads only) without the template. What percent of cells will randomly mutate to get HindIII recognition sites?
Also, seeing what happens using template only would be good. We would expect low baseline levels of HDR to occur right? I it is plausible few out of 10^5 or 10^6 cells will require repair at that locus even without any Cas9.
The papers I've looked at sequence and measure the on-target mutation rate, and don't have any steps in them that would select for mutants (because that would ruin the measurement). Where do you propose the selection for mutants would be happening?
Unless I'm misunderstanding something about how the experiments are done, your theory would require many groups to be independently committing scientific fraud, which is very implausible.
No fraud is necessary, just sloppy interpretation of data.
Staying with Schuman et al (2015) linked in this thread, they start with 2.5 x 10^5 cells and end up with 5 x 10^4 to 2 x 10^5 three to four days later. Why are there fewer cells even without accounting for any division? Because the treatment is toxic. This is reported in many papers.
I don't know what the proliferation rate is like for the cells in the conditions of that study, but apparently up to 7 divisions in 4 days is considered plausible for T-cells: http://www.ncbi.nlm.nih.gov/pubmed/17367338
If you're right and CRISPR doesn't actually work, then none of the papers published so far are replicable and you'll be vindicated in mere months. If that doesn't happen, then there's a flaw in the style of reasoning and research that led you to conclude the existing papers were flawed. I recommend jotting down a few notes about how you came to this conclusion, and making a calendar reminder to check how it turned out next year.
Not at all. I'm not sure you understand what I am saying.
It appears to me the data can be interpreted in multiple ways. Two different "theories" can explain the same results. This is a much more insidious problem than mere non-replication (I haven't seen any direct replications regarding CRISPR either though). People can continue on the wrong path for a long time by interpreting good, reliable data incorrectly.
https://en.wikipedia.org/wiki/Experimentum_crucis
Lol, what, just what... the biophysics of the Cas9 system are understood pretty well. We literally get as close as you can get to observing the accepted mechanism of action. How would you explain the consistency of site specific gene integration? You can't be selecting from existing mutants and "just happen" to get your transgenic product inserted at the exact site you specified. Your comment is just absurd. You also don't seem to realize that CRISPR is used at pretty much every university in dozens of different systems by thousands of different scientists. What a bizarre comment. Edit: uh, if you actually need a "source" for this:
http://m.pnas.org/content/109/39/E2579.full
This is very easy. If you take a very many cells, some small percent will be mutants at any given site (unless you claim zero background rates of mutation, which is absurd and also directly contradicted by the data in these same papers). If you give a treatment that raises/causes the affinity of DNA damaging substances for a certain site, this will selectively damage the DNA of the non-mutant cells. The proliferation of the non-mutants will be suppressed and many will die off. The remaining mutants will proliferate to fill the gap. See my other post for a (very simple) mathematical model of this phenomenon.
This is not absurd at all. It is basic logic and algebra. I will check that paper and get back to you. I actually have not read any using bacterial cells yet, thanks. Also, as far as I know there are no mathematical models of the standard proposed CRISPR mechanism that have been published, if you know of one that would be great.
That might be possible if CRISPR was just a site specific knock out system.
It's not. Your theory does not explain how site specific gene integration of transgenic products is possible if CRISPR/Cas is not an efficient site specific nuclease. If Cas9 is not cutting the DNA at the specific site so the transgenic product can integrate there, we wouldn't be getting the results seen.
What experiment in that paper do you think addresses the issue of selection vs modification? Both require the cleavage of specific DNA sequences, that is all I see reported in Gasiunas et al 2012.
Here, listen. The following two papers conclusively "disprove" your idea. Both use single embryo injection and show multiple successful site specific mutagenesis in groups of no more than 5 to 25 cells.
http://www.sciencedirect.com/science/article/pii/S0092867413...
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3686313/#SD1
Yang et al (2013): "To assess whether a marker transgene could be inserted into an endogenous locus, we coinjected Cas9 mRNA, sgRNA, and a double-stranded donor vector that was designed to fuse a p2AmCherry reporter with the last codon of the Nanog gene (Figure 2A). A circular donor vector was used to minimize random integrations. To assess toxicity and to optimize the concentration of donor DNA, we microinjected different amounts of Nanog-2A-mCherry vector. Injection with a high concentration of donor DNA (500 ng/ml) yielded mCherry-positive embryos with high efficiency, with most blastocysts being retarded, whereas injection with a lower donor DNA concentration (10 ng/ml) yielded mostly healthy blastocysts, most of which were mCherry-negative. When 200 ng/ml donor DNA was used, 75% (936/1,262) of the injected zygotes developed to blastocysts, 9% (86/936) of which were mCherry-positive (Figure 2C; Table S1)."
So efficiency is inversely proportional to toxicity, they treated many more than 5-25 cells (the selection would occur at the level of the embryo), and there was only 1-10% rate of mutation detection. Also, they used "Superovulated female B6D2F1 mice". This procedure leads to chromosomal abnormalities and probably genetic instability so we would expect elevated presence of mutations at any given site: http://jhered.oxfordjournals.org/content/77/1/39.full.pdf
I'll have to look closer at the HDR aspect though (primers used, etc). But what may be going on that usually they detect the insertion via PCR: there is one primer to a sequence unique to the cassette and another upstream or downstream that should only be in the cells. Then the segment spanning the junction is amplified which supposedly is conclusive evidence of insertion at the correct location. The problem is you can get single primer amplification and also the homology arms required for HDR are likely to contain similar sequences to the "cell-only" primer. Eg: http://link.springer.com/protocol/10.1385%2F0-89603-258-2%3A...
Hwang et al 2013: "On the next day, injected embryos were inspected under stereoscope and were classified as dead, deformed or normal phenotypes. Only embryos that developed normally were assayed for target site mutations"
They don't seem to tell us how many embryos were injected. And that study does not appear to use any type of control group at all. AFAICT, that is exactly the type of study that is consistent with a selection effect.
I'm not an expert in this area, but I still don't understand how you manage to reconcile site specific transgene insertion. In these studies reporter genes are clearly inserted and heritable. How is there anything more to the discussion?
Like, as reported by Doudna:
http://science.sciencemag.org/content/337/6096/816.short
"We show here that in a subset of these systems, the mature crRNA that is base-paired to trans-activating crRNA (tracrRNA) forms a two-RNA structure that directs the CRISPR-associated protein Cas9 to introduce double-stranded (ds) breaks in target DNA. At sites complementary to the crRNA-guide sequence, the Cas9 HNH nuclease domain cleaves the complementary strand, whereas the Cas9 RuvC-like domain cleaves the noncomplementary strand. The dual-tracrRNA:crRNA, when engineered as a single RNA chimera, also directs sequence-specific Cas9 dsDNA cleavage."
Which part of that mechanism do you doubt? It sounds like you doubt the dsDNA nuclease activity of Cas9. Why not just order a plasmid, some Cas9 + gdna, put them together and sanger sequence your products? If Cas9 isn't a site specific guided endonuclease you could prove it for $200.
Not at all. This would be why the treatment is toxic and suppressive of proliferation.
At this point, I still think the presence of indels at the site (ie the proposed NHEJ mechanism) is just as easily explained by selection for pre-existing mutants. The experiments involving insertion of DNA (ie the proposed HDR mechanism) are better, but lack controls for "off-target" PCR amplification when showing the gels. IE we need to know how often the template itself will be amplified under their primers/conditions, both free and if it gets incorporated in some random location.
When segments across the insertion junction are amplified, sequenced, and reported, I find this convincing as it is a precise prediction that matches the data and I can think of no other explanation. The other experiments are pretty much redundant and add nothing. However, the reports I have seen contain little methodological or quantitative information regarding these sequences which does make me remain skeptical, especially about claims of efficiency. Those claims seem to always be determined using the former experiments that can be explained in other ways.
This is a baseless critique.
No one has to address alternative hypotheses that don't make any sense. Are you unaware that Sanger Sequencing exists, and the actual lesions can be read? Or that heterologous genes are being introduced with CRISPR methods? Neither of these common results can be explained by the spontaneous insertion of hundreds of nucleotides that happen to precisely match the sequence of the construct being inserted.
Again, this is utter nonsense and demonstrates a complete absence of basic understanding in molecular biology.
The first is just as consistent with the selection mechanism, because low levels of baseline mutants ARE reported (see the Schumann et al and Hendel et al papers I linked to in this thread for examples).
The second would indeed be difficult to explain with a selection mechanism, unfortunately I have not seen that actually published. Instead, the primers used can just as well be amplifying the template and/or the sequence of the inserted cassette is not shown (eg Figure 2D and S1 here: http://www.sciencemag.org/content/348/6233/442 )
If you have a reference to a specific paper I would appreciate it.
What do you mean by the primers can just well be amplifying the template? How does that explain knock-ins without an actual insertion? And there are plenty of knock-in CRISPR papers out there. Just literally search for "CRISPR knock-in".
Let me ask this. Say you have sequence A that is not supposed to exist before your treatment and sequence B that you have added to the environment in large amounts. Is it safe to use primers where one matches exactly to sequence B and the other is this similar?
CTCATTAGGCACCCCAGGCTTTACA
CTCAGT------CCCAGGCTTTACA
Are you suggesting that they are just detecting the un-incorporated foreign DNA after CRISPR? I think the fact it has been shown that the knocked-in DNA is inherited to the progeny is strong enough evidence that the DNA was actually inserted.
Unless you want to argue that the un-incorporated DNA was also transmitted to the next generation, which honestly, is extremely unlikely.
That could possibly explain some results, but not those involving transmission. If the knocked-in DNA is transmitted to the next generation then I'd think it must have gotten incorporated somewhere, however, this need not be at the intended site if the primers are amplifying the template.
Then again, supposedly shingles is caused by extragenomic Varicella-zoster DNA that is somehow stable for decades and can be passed on during pregnancy. I'm not sure I believe that though, and of course that is viral DNA.
Anyway, in that Ruan et al (2015) they claim to have detected exactly the expected sequence across the junction in at least a few cells. I can't think of any explanation for that data other than CRISPR working as advertised. However, they don't report in what percent of the cells this was observed.
Edit: I mean supposedly those exact sequences shown in figure S2 never physically existed before and now they do, exactly as predicted by the theory. That is strong evidence.
Ok, I did that search and here is the first paper I found: http://www.nature.com/articles/srep14253
EDIT: Let me look again at this paper later.
Here is another. At first you may think they show successful insertion of GFP, but it turns out no! Instead all that needed to happen was mutation of an early stop codon: http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3712628/
That is why I am asking others to provide their own references. The papers I have read do not seem capable of distinguishing between modification vs selection after careful inspection.
the fight over CRISPR (which is a discovery of nature, not a creation), especially the fight over the monopoly to apply CRISPR to other fields of science is another example of why the GNU General Public License (or something with as many teeth) is required to keep science open and free.
The Villain of CRISPR is the Bayh–Dole Act.
Can someone share a tl;dr version of this?
CRISPR is a mechanism by which some species of bacteria and archea can edit a virus out of their genome -- it's essentially a small immune system. CRISPR is "hot" right now because of the potential to use it to edit arbitrary genomes. Bear in mind that the technique has a long way to go. It's more or less impossible to do it right now without causing a lot of side effects elsewhere in the genome.
As with most science, this has taken a long time and been the result of work by many, many scientists. Some scientists have big egos and are fighting about who the "real genius" is. Furthermore, it's widely thought that there's going to be a lot of money in this technique, if you can get a patent on it.
TL;DR; cool and potentially very useful science happened, now big egos, big greed, and people who would rather get rich and win a Nobel prize than share the discovery and its benefits with the world are having a fight about it.
Lander wrote an article in "Cell" about the history as he saw it of the invention of the Crispr technique. It covered the bases but was flawed, but it did include a lot of scientists that weren't included before. The article basically tries to discredit it. It wasn't a great argument and frankly the authors not a impartial (Friends with one of the scientist, and works at one of the universities) I'm surprised it made it this far on Hacker News.
There is a patent dispute about who owns the patent on this technique. Lots of money is potentially at stake. This article was written from one of the parties (Broad institute and UC Berkely) being one of them. Oddly the Lander article supports the notion that this invention is evolution not revolutionary.
Broad has been working to move from from CRISPR/CAS9 to CRISPR/Something else better). The UC Berkley seems to have come up with it first, but is it obvious or obvious to use in editing is the question. The UC [2]team has pulled all there patent claims and resubmitted them twice, presumably to broaden the scope and cover any use. Add some east coast/west coast rivalry and some other biases and you have a powder keg of science.
Anyway lots of blame to go around.
siyer posted this in a previous article which puts the patent dispute in context and if the patent is only cas9:
[1]http://www.ipscell.com/2016/01/patent-expert-weighs-in-on-cr...
and the strange patent application by UC and :
[2]https://law.stanford.edu/2015/12/29/the-crispr-patent-interf...
Egos are colliding over attribution. Go figure!
There’s a patent issue too, but it’s difficult to evaluate since the issue is between a non-profit (The Broad Institute of MIT and Harvard) and a public institution (University of California, Berkley) and most people acknowledge that either would be better for progress than any commercial entity.